Plasmid Preparation:Article Title: Endothelial TRIM47 regulates blood-brain barrier integrity and cognition via the KEAP1/NRF2 signalling pathway in mice.
Article Snippet: .. Flag-Keap1 was a gift from Qing Zhong (Addgene plasmid #28023; http://n2t.net/addgene:28023; RRID:Addgene_28023). pCDNA3-Myc3-Nrf2 was a gift from Yue Xiong (Addgene plasmid #21555; http://n2t.net/addgene:21555; RRID:Addgene_21555). pRK5-HA-Ubiquitin-WT was a gift from Ted Dawson (Addgene plasmid # 17608; http://n2t.net/addgene:17608; RRID:Addgene_17608). pHOGL3/4.5 and pHOGL3/4.5 Triple mutant plasmids were a gift from Prof. Anupam Agarwal (University of Alabama at Birmingham, US). .. The pHOGL3/4.5 double mutant was obtained from the pHOGL3/4.5 triple mutant in which mutation C>T was created into the mutated EBox by a rapid-site-directed-mutagenesis using the following non-overlapping primers (F: cacgtgacccgccgagcata; R: ggccaggcggaacagc) and PlatinumTMSuperFiTMII DNA Polymerase (Invitrogen). pGL3 Firefly Luciferase basic empty vector (Promega) was used as a control. pGL4.74 [hRluc/TK] vector] (Promega) Renilla luciferase vector was used as an internal control.
Article Title: Animal model for oxidative stress research and use thereof
Article Snippet: .. Specifically, a human HEK293T cell line is transfected with Flag-Keap1 (Addgene, MA, USA), pCDNA3-Myc3-Nrf2 (Addgene, MA, USA), or pcDNA3.1-HA-RCAT, wherein the expression vector pCDNA3.1-HA-RCAT which is constructed by conjugating Caenorhabditis elegans RCAT cDNA with pcDNA3.1-HA (Addgene, MA, USA). ..
Article Title: Covalent modification of Keap1 Cys489 by NU6300 activates Nrf2 signaling and suppresses NLRP3 inflammasome-mediated pyroptosis
Article Snippet: .. Plasmids Flag-Keap1, pCDNA3-Myc3-Nrf2, and mRFP-Ub plasmids were purchased from Addgene, and the p-ARE-luc plasmid was obtained from Beyotime (Beijing, China). .. The Flag-Keap1 C273A, Flag-Keap1 C288A, Flag-Keap1 C319A, Flag-Keap1 C434A, FlagKeap1 C489A, and Flag-Keap1 C613A point mutants were generated by polymerase chain reaction (PCR)-mediated site-directed mutagenesis using KOD Plus Neo DNA polymerase (Toyobo; Otsu, Japan), followed by subcloning into the corresponding expression vectors using the MonCloneTM Hi-Fusion Cloning Mix V2 kit (Monad; Shanghai, China).
Article Title: Endothelial TRIM47 regulates blood-brain barrier integrity and cognition via the KEAP1/NRF2 signalling pathway in mice
Article Snippet: .. Flag-Keap1 was a gift from Qing Zhong (Addgene plasmid #28023; http://n2t.net/addgene:28023 ; RRID:Addgene_28023). pCDNA3-Myc3-Nrf2 was a gift from Yue Xiong (Addgene plasmid #21555; http://n2t.net/addgene:21555 ; RRID:Addgene_21555). pRK5-HA-Ubiquitin-WT was a gift from Ted Dawson (Addgene plasmid # 17608; http://n2t.net/addgene:17608 ; RRID:Addgene_17608). pHOGL3/4.5 and pHOGL3/4.5 Triple mutant plasmids were a gift from Prof. Anupam Agarwal (University of Alabama at Birmingham, US). .. The pHOGL3/4.5 double mutant was obtained from the pHOGL3/4.5 triple mutant in which mutation C>T was created into the mutated EBox by a rapid-site-directed-mutagenesis using the following non-overlapping primers (F: cacgtgacccgccgagcata; R: ggccaggcggaacagc) and PlatinumTMSuperFiTMII DNA Polymerase (Invitrogen). pGL3 Firefly Luciferase basic empty vector (Promega) was used as a control. pGL4.74 [hRluc/TK] vector] (Promega) Renilla luciferase vector was used as an internal control.
Article Title: Cerebral Small Vessel Disease genetic determinant TRIM47 controls brain homeostasis via the NRF2 antioxidant system
Article Snippet: .. Flag-Keap1 was a gift from Qing Zhong (Addgene plasmid #28023; http://n2t.net/addgene:28023 ; RRID:Addgene_28023). pCDNA3-Myc3-Nrf2 was a gift from Yue Xiong (Addgene plasmid #21555; http://n2t.net/addgene:21555 ; RRID:Addgene_21555). pHOGL3/4.5 and pHOGL3/4.5 Triple mutant plasmids were a gift from Prof. Anupam Agarwal (University of Alabama at Birmingham, US). .. The pHOGL3/4.5 double mutant was obtained from the pHOGL3/4.5 triple mutant in which mutation C>T was created into the mutated EBox by a rapid-site-directed-mutagenesis using the following non-overlapping primers (F: cacgtgacccgccgagcata; R: ggccaggcggaacagc) and PlatinumTMSuperFiTMII DNA Polymerase (Invitrogen). pGL3 Firefly Luciferase basic empty vector (Promega) was used as a control. pGL4.74 [hRluc/TK] vector] (Promega) Renilla luciferase vector was used as an internal control.
Mutagenesis:Article Title: Endothelial TRIM47 regulates blood-brain barrier integrity and cognition via the KEAP1/NRF2 signalling pathway in mice.
Article Snippet: .. Flag-Keap1 was a gift from Qing Zhong (Addgene plasmid #28023; http://n2t.net/addgene:28023; RRID:Addgene_28023). pCDNA3-Myc3-Nrf2 was a gift from Yue Xiong (Addgene plasmid #21555; http://n2t.net/addgene:21555; RRID:Addgene_21555). pRK5-HA-Ubiquitin-WT was a gift from Ted Dawson (Addgene plasmid # 17608; http://n2t.net/addgene:17608; RRID:Addgene_17608). pHOGL3/4.5 and pHOGL3/4.5 Triple mutant plasmids were a gift from Prof. Anupam Agarwal (University of Alabama at Birmingham, US). .. The pHOGL3/4.5 double mutant was obtained from the pHOGL3/4.5 triple mutant in which mutation C>T was created into the mutated EBox by a rapid-site-directed-mutagenesis using the following non-overlapping primers (F: cacgtgacccgccgagcata; R: ggccaggcggaacagc) and PlatinumTMSuperFiTMII DNA Polymerase (Invitrogen). pGL3 Firefly Luciferase basic empty vector (Promega) was used as a control. pGL4.74 [hRluc/TK] vector] (Promega) Renilla luciferase vector was used as an internal control.
Article Title: Endothelial TRIM47 regulates blood-brain barrier integrity and cognition via the KEAP1/NRF2 signalling pathway in mice
Article Snippet: .. Flag-Keap1 was a gift from Qing Zhong (Addgene plasmid #28023; http://n2t.net/addgene:28023 ; RRID:Addgene_28023). pCDNA3-Myc3-Nrf2 was a gift from Yue Xiong (Addgene plasmid #21555; http://n2t.net/addgene:21555 ; RRID:Addgene_21555). pRK5-HA-Ubiquitin-WT was a gift from Ted Dawson (Addgene plasmid # 17608; http://n2t.net/addgene:17608 ; RRID:Addgene_17608). pHOGL3/4.5 and pHOGL3/4.5 Triple mutant plasmids were a gift from Prof. Anupam Agarwal (University of Alabama at Birmingham, US). .. The pHOGL3/4.5 double mutant was obtained from the pHOGL3/4.5 triple mutant in which mutation C>T was created into the mutated EBox by a rapid-site-directed-mutagenesis using the following non-overlapping primers (F: cacgtgacccgccgagcata; R: ggccaggcggaacagc) and PlatinumTMSuperFiTMII DNA Polymerase (Invitrogen). pGL3 Firefly Luciferase basic empty vector (Promega) was used as a control. pGL4.74 [hRluc/TK] vector] (Promega) Renilla luciferase vector was used as an internal control.
Article Title: Cerebral Small Vessel Disease genetic determinant TRIM47 controls brain homeostasis via the NRF2 antioxidant system
Article Snippet: .. Flag-Keap1 was a gift from Qing Zhong (Addgene plasmid #28023; http://n2t.net/addgene:28023 ; RRID:Addgene_28023). pCDNA3-Myc3-Nrf2 was a gift from Yue Xiong (Addgene plasmid #21555; http://n2t.net/addgene:21555 ; RRID:Addgene_21555). pHOGL3/4.5 and pHOGL3/4.5 Triple mutant plasmids were a gift from Prof. Anupam Agarwal (University of Alabama at Birmingham, US). .. The pHOGL3/4.5 double mutant was obtained from the pHOGL3/4.5 triple mutant in which mutation C>T was created into the mutated EBox by a rapid-site-directed-mutagenesis using the following non-overlapping primers (F: cacgtgacccgccgagcata; R: ggccaggcggaacagc) and PlatinumTMSuperFiTMII DNA Polymerase (Invitrogen). pGL3 Firefly Luciferase basic empty vector (Promega) was used as a control. pGL4.74 [hRluc/TK] vector] (Promega) Renilla luciferase vector was used as an internal control.
Expressing:Article Title: Animal model for oxidative stress research and use thereof
Article Snippet: Cell Line HEK293T cells (Korean Cell Line Bank, 21573) were maintained under conditions of 37° C. and 5% CO2 in a Dulbecco's Modified Eagle Medium (DMEM; Hyclone, HS3243.01) supplemented with 10% fetal bovine serum (Hyclone, SV30087.02) and 1% penicillin-streptomycin (Biowest, L0022). .. The expression vectors transfected into the cell line are as follows: Flag-Keap1 (Addgene, MA, USA); pCDNA3-Myc3-Nrf2 (Addgene, MA, USA); and pcDNA3.1-HA-RCAT. .. The expression vector pCDNA3.1-HA-RCAT was constructed by conjugating Caenorhabditis elegans RCAT cDNA with pcDNA3.1-HA (Addgene, MA, USA).
Article Title: Animal model for oxidative stress research and use thereof
Article Snippet: .. Specifically, a human HEK293T cell line is transfected with Flag-Keap1 (Addgene, MA, USA), pCDNA3-Myc3-Nrf2 (Addgene, MA, USA), or pcDNA3.1-HA-RCAT, wherein the expression vector pCDNA3.1-HA-RCAT which is constructed by conjugating Caenorhabditis elegans RCAT cDNA with pcDNA3.1-HA (Addgene, MA, USA). ..
Transfection:Article Title: Animal model for oxidative stress research and use thereof
Article Snippet: Cell Line HEK293T cells (Korean Cell Line Bank, 21573) were maintained under conditions of 37° C. and 5% CO2 in a Dulbecco's Modified Eagle Medium (DMEM; Hyclone, HS3243.01) supplemented with 10% fetal bovine serum (Hyclone, SV30087.02) and 1% penicillin-streptomycin (Biowest, L0022). .. The expression vectors transfected into the cell line are as follows: Flag-Keap1 (Addgene, MA, USA); pCDNA3-Myc3-Nrf2 (Addgene, MA, USA); and pcDNA3.1-HA-RCAT. .. The expression vector pCDNA3.1-HA-RCAT was constructed by conjugating Caenorhabditis elegans RCAT cDNA with pcDNA3.1-HA (Addgene, MA, USA).
Article Title: Animal model for oxidative stress research and use thereof
Article Snippet: .. Specifically, a human HEK293T cell line is transfected with Flag-Keap1 (Addgene, MA, USA), pCDNA3-Myc3-Nrf2 (Addgene, MA, USA), or pcDNA3.1-HA-RCAT, wherein the expression vector pCDNA3.1-HA-RCAT which is constructed by conjugating Caenorhabditis elegans RCAT cDNA with pcDNA3.1-HA (Addgene, MA, USA). ..
Construct:Article Title: Animal model for oxidative stress research and use thereof
Article Snippet: .. Specifically, a human HEK293T cell line is transfected with Flag-Keap1 (Addgene, MA, USA), pCDNA3-Myc3-Nrf2 (Addgene, MA, USA), or pcDNA3.1-HA-RCAT, wherein the expression vector pCDNA3.1-HA-RCAT which is constructed by conjugating Caenorhabditis elegans RCAT cDNA with pcDNA3.1-HA (Addgene, MA, USA). ..
Ubiquitin Proteomics:Article Title: Slingshot homolog-1-mediated Nrf2 sequestration tips the balance from neuroprotection to neurodegeneration in Alzheimer's disease.
Article Snippet: .. Plasmids pcDNA3- EGFP- C4- Nrf2 (Addgene, 21549) (74), pCDNA3- Myc3- Nrf2 (Addgene, 21555) (74), pREP- 8xARE- GFPSV40- BFP (Addgene, 13,4910) (39), and HA- Ubiquitin (Addgene, 18,712) (75) were obtained from Addgene. p3xFlag- SSH1, p3xFlag- SSH1ΔC, p3xFlagSSH1ΔN, pEGFP- N1- p62- S403E, and pEGFP- N1- p62- S403A were previously generated by the Kang Lab (31, 38). p3xFlag- SSH1- CS was generated by the Kang lab during this study. p62- S349A- pEGFP- N1 (76) was kindly provided by Tanji Konikazu (Hirosaki University, Japan). .. Signal Silence SQSTM1/p62 siRNA II ® (Cell Signaling Technologies, 6,399) and SSH1 siRNA (Dharmacon, GE Healthcare; 5′- GAGGAGCUGUCCCGAUGAC- 3′) were obtained from the indicated sources.
Generated:Article Title: Slingshot homolog-1-mediated Nrf2 sequestration tips the balance from neuroprotection to neurodegeneration in Alzheimer's disease.
Article Snippet: .. Plasmids pcDNA3- EGFP- C4- Nrf2 (Addgene, 21549) (74), pCDNA3- Myc3- Nrf2 (Addgene, 21555) (74), pREP- 8xARE- GFPSV40- BFP (Addgene, 13,4910) (39), and HA- Ubiquitin (Addgene, 18,712) (75) were obtained from Addgene. p3xFlag- SSH1, p3xFlag- SSH1ΔC, p3xFlagSSH1ΔN, pEGFP- N1- p62- S403E, and pEGFP- N1- p62- S403A were previously generated by the Kang Lab (31, 38). p3xFlag- SSH1- CS was generated by the Kang lab during this study. p62- S349A- pEGFP- N1 (76) was kindly provided by Tanji Konikazu (Hirosaki University, Japan). .. Signal Silence SQSTM1/p62 siRNA II ® (Cell Signaling Technologies, 6,399) and SSH1 siRNA (Dharmacon, GE Healthcare; 5′- GAGGAGCUGUCCCGAUGAC- 3′) were obtained from the indicated sources.
|
Addgene inc is a verified supplier 